Skip to main content

UCSC Genome Browser

Visualization of Genomic Data

Once you have processed your sequencing data and generated bigWig files, you can visualize them in the UCSC Genome Browser.

On the CCB cluster, data files must be moved to a web-accessible directory (ie the datashare folder) and then you can load the bigWig files as custom tracks in the UCSC Genome Browser.

To load your bigWig files as custom tracks, follow these steps:

  1. Move your bigWig files to a web-accessible directory (e.g. datashare folder).
  2. Go to the UCSC Genome Browser website: https://genome.ucsc.edu/
  3. Go to the genome assembly that the data has been aligned to.
  4. Click on the My Data then Custom Tracks in the top menu.
  5. Click on the Add Custom Tracks button.
  6. In the text box, enter the URL to your bigWig file in the following format:
track type=bigWig name="Sample Track" description="Description of the track" bigDataUrl=http://path/to/your/file.bw
  1. Click on the Submit button to load the custom track. The custom track will now be visible in the genome browser, and you can navigate to the regions of interest to visualize the coverage and peaks. You can also customize the display settings for the track (e.g. color, height) to improve visualization.

Alternatively, you can directly load bigWig files from the GEO database, if they are provided in a GEO submission. This can be done by copying the FTP URL from the “Supplementary files” section into the Custom Tracks box. Make sure to use the correct genome reference when loading the track.

BLAT searches

If you have a sequence and want to find where it is located in the genome, you can use the BLAT tool on the UCSC Genome Browser. BLAT (BLAST-like Alignment Tool) allows you to quickly find the location of a sequence in the genome.

Give it a go!

This is a sequence from a PCR product that was generated in a diagnositics lab. We want to find out where it is located in the genome and what mutation it contains.

Test sequence:

GTCCCCACTGTCGTCGCGGCCTGGGGTTCACTTGGGGGGCGCCTTGGGGAGGTTCACTTGGAGGCTGGGGCAGGAGGATCACTTAAGTCCAGGAGTTCAAGGCTGCAGTAAGCCATGACTACAACACTGCACTCCAGCATGGGTGACAAAGCAAGCATCGTCTCAAAAAAAATAAATAAATAATTTTGGCCAGGTGCCGTGGCTTACGCCTGTGATCCCAGCACTTTGGGAGGTCAAGGCGGGTGGATCACGAGGTCAGGAGTCCAAGACCAGCCTGGCCAAGATGGTGAAACGTTGTCTCTACTAAAAATACAACAATTAGCCGGGCATGGTGGCGGGCCCCTGTATTCCCAGCTAGTCGGGAGGCTGAGGCAGAGGGTGCAGTGAGCCGAGACTGCATCACCGCGCTCTAGCCTAGGAGACAGAGCGAGACTCCGTCT

To run a BLAT search on the UCSC Genome Browser, follow these steps:

  1. Go to the UCSC Genome Browser website: https://genome.ucsc.edu/
  2. Go to the human genome assembly hg38.
  3. Click on the Tools then Blat in the top menu.
  4. Paste the test sequence into the input box.
  5. Click on the Submit button to run the BLAT search.

The BLAT search will return a list of matches for the input sequence in the genome. You can click on the matches to view the genomic location and any associated annotations. This can help you identify the gene or region of the genome that the sequence is located in, and any potential mutations or variants that may be present.

In this case the sequence is located on chr16, and initially aligns to chr16:165342-165396, but then has a large gap with a second alignment at chr16:184701-185085. This suggests the sequence contains a large deletion of approximately 19kb. This is a known pathogenic mutation known as the SEA deletion, which is a common cause of alpha-thalassemia in Southeast Asian populations. The SEA deletion removes both the HBA2 and HBA1 gene, leading to reduced production of alpha-globin and resulting in anemia.

Conservation tracks

The UCSC Genome Browser also provides conservation tracks that show the conservation of genomic regions across different species. These tracks can help you identify regions of the genome that are evolutionarily conserved, which may indicate functional importance.

These are found under the “Comparative Genomics” section of the UCSC Genome Browser. You can select different species to compare and view the conservation scores for each region of the genome.

There are different types of conservation tracks, such as PhastCons and PhyloP, which use different methods to calculate conservation scores. PhastCons scores range from 0 to 1, with higher scores indicating higher conservation. PhyloP scores can be positive or negative, with positive scores indicating conservation and negative scores indicating acceleration (faster evolution than expected).

These conservation tracks are generated by comparing the genome of interest to the genome of other species. The conservations cores may be different depending on the species you choose to compare with. There are also different levels of conservation tracks, such as 100 vertebrates, 20 mammals, etc., which show conservation across different groups of species.

These scores are often represented as a graph, where higher scores indicate higher conservation. You can also view the specific sequences that are conserved across species by clicking on the conservation track.